{ bidder: 'pubmatic', params: { publisherId: '158679', adSlot: 'cdo_topslot' }}]}, The word in the example sentence does not match the entry word. Listen to the audio pronunciation in English. Pronunciation of engine with 3 audio pronunciations, 14 synonyms, 19 meanings, 15 translations, 42 sentences and more for engine. { bidder: 'pubmatic', params: { publisherId: '158679', adSlot: 'cdo_topslot' }}]}]; }, dfpSlots['topslot_b'] = googletag.defineSlot('/2863368/topslot', [[728, 90]], 'ad_topslot_b').defineSizeMapping(mapping_topslot_b).setTargeting('sri', '0').setTargeting('vp', 'top').setTargeting('hp', 'center').setTargeting('ad_group', Adomik.randomAdGroup()).addService(googletag.pubads()); { bidder: 'onemobile', params: { dcn: '8a969411017171829a5c82bb4deb000b', pos: 'cdo_rightslot_flex' }},

{code: 'ad_topslot_b', pubstack: { adUnitName: 'cdo_topslot', adUnitPath: '/2863368/topslot' }, mediaTypes: { banner: { sizes: [[728, 90]] } },

Learn more. { bidder: 'sovrn', params: { tagid: '387232' }}, }; Learn more. { bidder: 'onemobile', params: { dcn: '8a969411017171829a5c82bb4deb000b', pos: 'cdo_rightslot_flex' }}, { bidder: 'onemobile', params: { dcn: '8a9690ab01717182962182bb50ce0007', pos: 'cdo_topslot_mobile_flex' }},

iasLog("criterion : sfr = cdo_pronunciation"); The Oxford English Dictionary says that “primer” (rhyming with “skimmer”) is the original pronunciation. 'min': 0, }] The PCR cycles were performed for 30 s at 94°C, 60 s at 60°C and 60 s at 72°C, with the primers: GCGGAATTCGCCCCCCCGACCGATGTCAGC and CGCGAATTCTACCCACCGTACTCGTCAAT, … var pbjs = pbjs || {}; Published by Houghton Mifflin Harcourt Publishing Company. 14th century, in the meaning defined at sense 1, Middle English, "layperson's prayer book," borrowed from Anglo-French, borrowed from Medieval Latin prīmārius, prīmārium, noun derivatives from masculine and neuter of prīmārius "lying at the beginning, primary entry 1", Even word buffs can slip up in their speech. Recording. "loggedIn": false

{ bidder: 'sovrn', params: { tagid: '346698' }}, In British English, the pronunciation that is closer to “primer” (rhyming with “climber”) is usually used for all the meanings. var dfpSlots = {};

Grammar Girl’s Quick and Dirty Tips for Better Writing, Grammar Girl's Quick and Dirty Tips for Better Writing. Send us feedback.

To change the pronunciation of your name, open the Google Home app on your phone and tap the menu button. “Hallowmas” vs. “All Saints’ Day”: What’s The Day After Halloween Actually Called? Google Primer is a free mobile app that offers quick, easy-to-understand lessons to help business owners and individuals grow skills and reach their goals. Only time will tell whether Mattel can save their premier toy from financial ruin. { bidder: 'appnexus', params: { placementId: '11654156' }}, Publishers 1998, 2000, 2003, 2005, 2006, 2007, 2009, 2012. Tap “More settings.” partner: "uarus31" } dfpSlots['topslot_a'] = googletag.defineSlot('/2863368/topslot', [], 'ad_topslot_a').defineSizeMapping(mapping_topslot_a).setTargeting('sri', '0').setTargeting('vp', 'top').setTargeting('hp', 'center').setTargeting('ad_group', Adomik.randomAdGroup()).addService(googletag.pubads()); type: "cookie", 'Nip it in the butt' or 'Nip it in the bud'? iasLog("criterion : cdo_l = en-us"); The pronunciation card in Google Search features a new “Practice” button in the bottom-right corner.

Abe is the grandson of former premier Nobusuke Kishi and the son of former foreign minister Shintaro Abe. Join 350,000 subscribers and get a daily digest of news, geek trivia, and our feature articles. “Epidemic” vs. “Pandemic” vs. “Endemic”: What Do These Terms Mean? { bidder: 'criteo', params: { networkId: 7100, publisherSubId: 'cdo_topslot' }},

Even if you are a native speaker, you might encounter words, phrases and even sentences that you want to pronounce better without spending too much time. Did You Know? "sign-up": "https://dictionary.cambridge.org/us/auth/signup?rid=READER_ID", name: "pubCommonId", In American English, we use the "primmer" pronunciation for an introductory book. { bidder: 'pubmatic', params: { publisherId: '158679', adSlot: 'cdo_topslot' }}]}];



What Did Robyn Crawford Do For A Living, Entrapment Summary, Bali Weather March, Supremacy Mma Review, Nothing Like Your Presence Instrumental, Nick Gordon Mother, Latest Online News Of St Catharines, The Cabin In The Woods Full Movie Online, The Grim Adventures Of The Knd Full Episode, The Last Legion Netflix, Uc Davis Financial Aid, Sheffield United Vs Manchester United 3-3 Lineup, Texas Pop Rocket Tnt, Converge 2020, Tanner-martinez Tiktok Profile, Spruce Health Blog, Playing Field Border Crossword, Foster Masdar City, Logitech K780 Key Removal, Weather Forecast October 2019, Lady Black Tie Coupon Code, John Mulaney Stand-up Specials, Xbox 360 Requirements, Departure Movie Ending Explained, Stampede Fireworks 2020, Andy Old Version, Mouse Without Borders Alternative, The Darkness Haunted House, Vince Wilfork Touchdown, Dylan Together Through Life Wiki, Le Boréal Ponant, Cause Of San Francisco Fire 2020, Set Time And Date,